OMIA:001867-9940 : Lissencephaly and cerebellar hypoplasia, RELN-related in Ovis aries (sheep)

In other species: dog

Categories: Nervous system phene

Links to possible relevant human trait(s) and/or gene(s) in OMIM: 257320 (trait) , 600514 (gene)

Links to relevant human diseases in MONDO:

Single-gene trait/disorder: yes

Mode of inheritance: Autosomal recessive

Disease-related: yes

Key variant known: yes

Year key variant first reported: 2013

Cross-species summary: Renamed from 'Lissencephaly and cerebellar hypoplasia' to 'Lissencephaly and cerebellar hypoplasia, RELN-related' [22/09/2023]

Species-specific symbol: LCH

History: Pérez et al. (2013) provided the first report in the peer-reviewed literature of this disorder in a particular breed of sheep.

Inheritance: As reported by Pérez et al. (2013), "The analysis of the three pedigrees, including 14 affected animals . . . was consistent with a monogenic autosomal recessive inheritance".

Mapping: By conducting a GWAS/homozygosity-mapping analysis on 7 affected and 33 normal Churra sheep, each genotyped with the OvineSNP50 SNP Chip (yielding 47,864 informative SNPs), Suárez-Vega et al. (2013) mapped this disorder to a 4.8Mb region on chromosome OAR4.

Molecular basis: Sequencing of the most likely functional candidate gene in the candidate region (see Mapping section) enabled Suárez-Vega et al. (2013) to identify the causative mutation: "a deletion of 31 bp (c.5410_5440del) in predicted exon 36 of RELN, resulting in a premature termination codon. A functional analysis of this mutation revealed decreased levels of RELN mRNA and a lack of reelin protein in the brain cortex and blood of affected lambs."

Clinical features: Pérez et al. (2013) reported this disorder in "42 newborn lambs from a pure Churra breed flock, with clinical signs of weakness, inability to walk, difficulty in sucking and muscular rigidity observed immediately after birth. All the lambs showed near-total agyria with only a rudimentary formation of few sulci and gyri, and a severe cerebellar hypoplasia."

Pathology: As explained by Pérez et al. (2013), "The pathological features reported are consistent with the type LCH-b (lissencephaly with cerebellar hypoplasia group b) defined in human medicine".

Breed: Spanish Churro (Sheep) (VBO_0001619).
Breeds in which the phene or likely causal variants have been documented. If a likely causal variant has been documented, see variant-specific breed information in the variant table. (Breed information may be incomplete).

Associated gene:

Symbol Description Species Chr Location OMIA gene details page Other Links
RELN reelin Ovis aries 4 NC_056057.1 (46693920..46157799) RELN Ensembl, NCBI gene

Variants

By default, variants are sorted chronologically by year of publication, to provide a historical perspective. Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column headers.

WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.

Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.

OMIA Variant ID Breed(s) Variant Phenotype Gene Allele Variant Type Variant Effect Source of Genetic Variant Pathogenicity Classification* Reference Sequence Chr. g. or m. c. or n. p. Verbal Description EVA ID Year Published PubMed ID(s) Acknowledgements
1663 Lissencephaly and cerebellar hypoplasia RELN missense Naturally occurring variant Not currently ISAG evaluated Entry has been created to generate an OMIAvariantID for a variant that is currently in the process of being published. Information will be updated once manuscript has been published. 2024 39394905
673 Spanish Churro (Sheep) Lissencephaly and cerebellar hypoplasia RELN deletion, gross (>20) Naturally occurring variant Not currently ISAG evaluated Oar_rambouillet_v1.0 4 g.50313243_50313273del c.5410_5440del A deletion of 31 bp (GATGTAAGTTCCCATTGAAATCATCTTTAAG) in predicted exon 36 of RELN would lead to a truncated protein of 1817 amino acids (1803 amino acids of normal reelin followed by 14 missense amino acids and a premature termination codon) 2013 24260534 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.

* Variant pathogenicity for single gene diseases as evaluated by an expert panel of the International Society of Animal Genetics (ISAG) Animal Genetic Testing Standardization Standing Committee

Clinical synopsis/links to phenotypes

Variant Phenotype(s) References (Pubmed ID)
Common phenotypes MP:0020289: astasia
UPHENO:0081099: cerebellum hypoplasia
39394905
MP:0020829: abnormal forebrain tissue architecture
MP:0020289: astasia
24260534
673 MP:0020829: abnormal forebrain tissue architecture
MP:0001436: abnormal suckling behavior
MP:0020289: astasia
MP:0001393: ataxia
UPHENO:0081099: cerebellum hypoplasia
MP:0000825: dilated lateral ventricle
HP:0001339: Lissencephaly
MP:0011100: preweaning lethality, complete penetrance
MP:0000746: weakness
24260534
1663 MP:0020829: abnormal forebrain tissue architecture
MP:0001406: abnormal gait
MP:0002090: abnormal vision
MP:0020289: astasia
UPHENO:0081099: cerebellum hypoplasia
MP:0000825: dilated lateral ventricle
HP:0002346: Head tremor
HP:0001339: Lissencephaly
MP:0011100: preweaning lethality, complete penetrance
39394905

Contact us

If you notice anything missing or in need of change, please contact us at: [email protected].

Cite this entry

Nicholas, F. W., Tammen, I., & Sydney Informatics Hub. (2025). OMIA:001867-9940: Online Mendelian Inheritance in Animals (OMIA) [dataset]. https://omia.org/. https://doi.org/10.25910/2AMR-PV70

References

Note: the references are listed in reverse chronological order (from the most recent year to the earliest year), and alphabetically by first author within a year.

2024 Manning, L.K., Winkenwerder, E., Baskind, L., Eager, K.L.M., Willet, C.E., Porebski, B., O'Rourke, B.A., Tammen, I., Gimeno, M., Pinczowski, P. :
A novel missense variant in the <i>RELN</i> gene in sheep with lissencephaly and cerebellar hypoplasia. Vet Pathol :3009858241283501, 2024. Pubmed reference: 39394905. DOI: 10.1177/03009858241283501.
2013 Pérez, V., Suárez-Vega, A., Fuertes, M., Benavides, J., Delgado, L., Ferreras, M.C., Arranz, J.J. :
Hereditary lissencephaly and cerebellar hypoplasia in Churra lambs. BMC Vet Res 9:156, 2013. Pubmed reference: 23938146. DOI: 10.1186/1746-6148-9-156.
Suárez-Vega, A., Gutiérrez-Gil, B., Cuchillo-Ibáñez, I., Sáez-Valero, J., Pérez, V., García-Gámez, E., Benavides, J., Arranz, J.J. :
Identification of a 31-bp deletion in the RELN gene causing lissencephaly with cerebellar hypoplasia in sheep. PLoS One 8:e81072, 2013. Pubmed reference: 24260534. DOI: 10.1371/journal.pone.0081072.

Edit History


  • Created by Frank Nicholas on 16 Aug 2013
  • Changed by Frank Nicholas on 16 Aug 2013
  • Changed by Frank Nicholas on 24 Nov 2013
  • Changed by on 20 Jan 2025