OMIA:002837-9646 : Coat colour, brown and white, BACE2-related in Ailuropoda melanoleuca (giant panda) |
Categories: Pigmentation phene
Links to possible relevant human trait(s) and/or gene(s) in OMIM: 605668 (gene)
Single-gene trait/disorder: yes
Mode of inheritance: Autosomal recessive
Disease-related: no
Key variant known: yes
Year key variant first reported: 2024
Species-specific description: Brown-and-white giant pandas are distinct coat color mutants first reported in 1985 in the Qinling Mountains, Shaanxi, China (Guan et al., 2024).
Molecular basis: Guan et al. (2024) "identified the genetic basis for [the white and brown] coat color variation using a combination of field ecological data, population genomic data, and a CRISPR-Cas9 knockout mouse model. [The aurhors] de novo assembled a long-read-based giant panda genome and resequenced the genomes of 35 giant pandas, including two brown pandas and two family trios associated with a brown panda. [The authors] identified a homozygous 25-bp deletion in the first exon of Bace2, a gene encoding amyloid precursor protein cleaving enzyme, as the most likely genetic basis for brown-and-white coat color. This deletion was further validated using PCR and Sanger sequencing of another 192 black giant pandas and CRISPR-Cas9 edited knockout mice. [The] investigation revealed that this mutation reduced the number and size of melanosomes of the hairs in knockout mice and possibly in the brown panda, further leading to the hypopigmentation."
Associated gene:
| Symbol | Description | Species | Chr | Location | OMIA gene details page | Other Links |
|---|---|---|---|---|---|---|
| BACE2 | beta-secretase 2 | Ailuropoda melanoleuca | 1 | NC_048218.1 (4466610..4384292) | BACE2 | Ensembl, NCBI gene |
Variants
By default, variants are sorted chronologically by year of publication, to provide a historical perspective.
Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending
order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column
headers.
WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.
Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.
| OMIA Variant ID | Breed(s) | Variant Phenotype | Gene | Allele | Variant Type | Variant Effect | Source of Genetic Variant | Pathogenicity Classification* | Reference Sequence | Chr. | g. or m. | c. or n. | p. | Verbal Description | EVA ID | Year Published | PubMed ID(s) | Acknowledgements |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1676 | Coat colour, brown white | BACE2 | deletion, gross (>20) | Naturally occurring variant | Not currently ISAG evaluated | 1 | c.176_200del | Published as c.176_200delTCGCCCTGGAGCCCGCCGGCGGCGC; g.4545815_4545839del | 2024 | 38437540 |
* Variant pathogenicity for single gene diseases as evaluated by an expert panel of the International Society of Animal Genetics (ISAG) Animal Genetic Testing Standardization Standing Committee
Contact us
If you notice anything missing or in need of change, please contact us at: [email protected].
Cite this entry
Nicholas, F. W., Tammen, I., & Sydney Informatics Hub. (2024). OMIA:002837-9646: Online Mendelian Inheritance in Animals (OMIA) [dataset]. https://omia.org/. https://doi.org/10.25910/2AMR-PV70
References
Note: the references are listed in reverse chronological order (from the most recent year to the earliest year), and alphabetically by first author within a year.
| 2024 | Guan, D., Sun, S., Song, L., Zhao, P., Nie, Y., Huang, X., Zhou, W., Yan, L., Lei, Y., Hu, Y., Wei, F. : |
| Taking a color photo: A homozygous 25-bp deletion in Bace2 may cause brown-and-white coat color in giant pandas. Proc Natl Acad Sci U S A 121:e2317430121, 2024. Pubmed reference: 38437540. DOI: 10.1073/pnas.2317430121. | |
| 2010 | Nicholls, H. : |
| Mystery of the giant brown panda deepens. Nature , 2010. DOI: 10.1038/news.2010.19. |
Edit History
- Created by Imke Tammen2 on 08 Apr 2024
- Changed by Imke Tammen2 on 08 Apr 2024